Longest ORF

Find the longest complete start-to-stop ORF and its protein length.

Description

A complete open reading frame starts at AUG and reaches an in-frame stop.

A complete open reading frame starts at AUG and reaches an in-frame stop. Its coding length here includes the start codon and excludes the terminating stop codon.^[1]

Find the longest complete start-to-stop ORF and its protein length.

When to use Longest ORF

Use this tool to find the longest complete start-to-stop ORF and its protein length.

Prepare the upstream counts, expression values, sequences or record lists requested by this tool. Keep corresponding features in the same order and confirm count units, transformations and caller-selected criteria.

How to use Longest ORF and understand its results

Prepare the upstream counts, expression values, sequences or record lists requested by this tool. Keep corresponding features in the same order and confirm count units, transformations and caller-selected criteria.
Enter rnaSequence using the field table and calculation rules, then run the tool.
Read startIndex, codingBases, proteinLength. The explanation below defines the units, signs, ordering and any flags or placeholder values.
If the tool reports an input issue, correct the values and run it again. Apply the stated assumptions when interpreting a successfully returned result.

Input field	Meaning	Value type; see rules below	Requirement
rnaSequence	RNA sequence	string	Required

Enter nonempty A/C/G/T/U text without whitespace. Uppercase and convert U to T, search every ATG start and stop at its first in-frame TAA/TAG/TGA. Keep the longest coding span; ties retain the earlier start. Return zero-based start, coding bases and amino-acid count. No complete ORF is an error.

codingBases=stopStart−startIndex; proteinLength=codingBases/3

Units, indexing, boundary conditions and exceptional cases are defined in the calculation rules above.

Output field	Meaning	Value type
startIndex	Start index	number
codingBases	Coding bases	number
proteinLength	Protein length	number

json

{
  "input": {
    "rnaSequence": "CCCATGAAATAAGGGATGTAA"
  },
  "output": {
    "startIndex": 3,
    "codingBases": 6,
    "proteinLength": 2
  }
}

Limitations and assumptions

Only the supplied strand and standard start/stop rules are scanned. No protein sequence, alternative genetic code, translation confidence or coding-potential model is returned.

Numeric inputs must be finite. Follow the calculation-specific rules for overflow, underflow and exceptional cases. Extremely large text inputs are rejected. Missing required fields, extra fields, wrong value types and violations of the calculation rules are input errors.

Alternative or Complementary methods

Use lncRNA Coding Potential Gate: Gate a supplied lncRNA coding-potential probability. For a complementary task, use Effective Transcript Length: Union overlapping exon intervals and subtract fragment length to estimate transcript effective length.

References

Longest ORF — tool.io

Similar or alternative tools

lncRNA Coding Potential Gate
Gate a supplied lncRNA coding-potential probability.
Effective Transcript Length
Union overlapping exon intervals and subtract fragment length to estimate transcript effective length.