Terminal Telomere Repeats
Count exact copies of the supplied motif at both sequence ends and report their combined span without counting overlaps twice.
Description
Telomeric sequence motifs can repeat at a sequence’s ends.
Telomeric sequence motifs can repeat at a sequence’s ends. Terminal motif counting depends on the supplied orientation and exact sequence.
Count exact copies of the supplied motif at both sequence ends and report their combined span without counting overlaps twice.
When to use Terminal Telomere Repeats
Use this for the following task: Count exact copies of the supplied motif at both sequence ends and report their combined span without counting overlaps twice.
Prepare the caller-filtered sequences, counts, coordinates or annotations requested below. Keep identifiers and paired lists aligned on the same reference.
How to use Terminal Telomere Repeats and understand its results
- Prepare the caller-filtered sequences, counts, coordinates or annotations requested below. Keep identifiers and paired lists aligned on the same reference.
- Enter sequence, repeatMotif using the field table, then run the tool.
- Read leftTerminalCopies, rightTerminalCopies, terminalRepeatBases. Interpret flags, units, ordering and placeholder values using the rules below.
- Review any reported issue or failed check, correct the supplied values when appropriate, and verify the result in its intended context.
| Input field | Meaning | Value type and bounds | Requirement |
|---|---|---|---|
| sequence | Sequence | string; minimum text length 1; maximum text length 1000000; pattern ^\s*[ACGTacgt]+\s*$ | Required |
| repeatMotif | Exact motif to match at both ends of the supplied strand; no reverse-complement inference. | string; minimum text length 1; maximum text length 1000000; pattern ^\s*[ACGTacgt]+\s*$ | Required |
Normalize canonical DNA and count consecutive exact copies from both ends. Cap their combined span at the sequence length so overlapping end runs are not counted twice.1
terminal span = min(sequenceLength, (leftCopies+rightCopies) motifLength) This summarizes the declared operation. Units, indexing, inclusivity and exceptional cases are explained in the surrounding text.
| Output field | Meaning | Value type |
|---|---|---|
| leftTerminalCopies | Left terminal copies | integer |
| rightTerminalCopies | Right terminal copies | integer |
| terminalRepeatBases | Bases in the union of terminal motif runs; overlaps are counted once. | integer |
{
"input": {
"sequence": "TTAGGGTTAGGGACGTTTAGGG",
"repeatMotif": "TTAGGG"
},
"output": {
"leftTerminalCopies": 2,
"rightTerminalCopies": 1,
"terminalRepeatBases": 18
}
}Limitations and assumptions
This does not infer biological telomeres, allow mismatches or automatically reverse-complement the motif.
The tool operates on supplied local data; alignment, filtering and annotation must already be appropriate for the stated calculation. Malformed requests produce input errors. A successfully evaluated request can still contain false flags, empty result lists or a result outside the supplied threshold; those outcomes have the meanings stated above.
Alternative or Complementary methods
Choose Tandem Repeat Copy Number for this operation: Find the longest exact DNA motif run at zero-based half-open positions, choosing the earliest tie. For a complementary task, use SSR Motif Class for this operation: Reduce an SSR motif to its primitive repeat unit and classify its base length.
The implementation reference documents the exact calculation, supported input shapes and returned fields.
References
-
Terminal Telomere Repeats — tool.io
Similar or alternative tools
- Tandem Repeat Copy Number
Find the longest exact DNA motif run at zero-based half-open positions, choosing the earliest tie.
- SSR Motif Class
Reduce an SSR motif to its primitive repeat unit and classify its base length.